nebuffer restriction digest buffer Search Results


99
New England Biolabs hindiii
Hindiii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hindiii/product/New England Biolabs
Average 99 stars, based on 1 article reviews
hindiii - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

99
Thermo Fisher restriction digestion buffer cutsmart 10x
Restriction Digestion Buffer Cutsmart 10x, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/restriction digestion buffer cutsmart 10x/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
restriction digestion buffer cutsmart 10x - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

97
New England Biolabs nebuffer 3 1
Nebuffer 3 1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebuffer 3 1/product/New England Biolabs
Average 97 stars, based on 1 article reviews
nebuffer 3 1 - by Bioz Stars, 2026-06
97/100 stars
  Buy from Supplier

99
New England Biolabs cutsmart buffer
Cutsmart Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cutsmart buffer/product/New England Biolabs
Average 99 stars, based on 1 article reviews
cutsmart buffer - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

97
New England Biolabs r0156 r0156 cutsmart buffer new
R0156 R0156 Cutsmart Buffer New, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/r0156 r0156 cutsmart buffer new/product/New England Biolabs
Average 97 stars, based on 1 article reviews
r0156 r0156 cutsmart buffer new - by Bioz Stars, 2026-06
97/100 stars
  Buy from Supplier

90
Promega rq1 dnase buffer
Rq1 Dnase Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rq1 dnase buffer/product/Promega
Average 90 stars, based on 1 article reviews
rq1 dnase buffer - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

96
New England Biolabs 1x digestion buffer
1x Digestion Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1x digestion buffer/product/New England Biolabs
Average 96 stars, based on 1 article reviews
1x digestion buffer - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

97
New England Biolabs 10x restriction enzyme buffer
10x Restriction Enzyme Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/10x restriction enzyme buffer/product/New England Biolabs
Average 97 stars, based on 1 article reviews
10x restriction enzyme buffer - by Bioz Stars, 2026-06
97/100 stars
  Buy from Supplier

96
New England Biolabs haeiii restriction endonuclease
Haeiii Restriction Endonuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/haeiii restriction endonuclease/product/New England Biolabs
Average 96 stars, based on 1 article reviews
haeiii restriction endonuclease - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

99
New England Biolabs cas9 expression plasmid
QC2 mutagenesis with SuperFi II polymerase to engineer <t>Cas9</t> mutants. ( A ) Domain organization of Cas9 (1.1) [ , ]. Five mutants to be engineered are indicated. Upstream from the coding sequence is the CAG promoter, a synthetic promoter composed of a CMV promoter, a β-actin promoter and an intron . The CAG promoter possesses GC-rich sequences that render the plasmid incompatible with the PCR conditions described for P3a mutagenesis, so the P3b PCR conditions were used instead . ( B ) Efficiency of QC2 mutagenesis via SuperFi II DNA polymerase. An expression plasmid for human Cas9 (1.1) [ , ], as depicted in panel A, was used as the PCR template under the P3b conditions . ( C ) Analysis of 6 plasmids sequenced for engineering the K562D mutant. Clone #6 possessed two insertions, which shared two repeats of a 27-nucleotide sequence (AGTGACCGTGGATCAGCTGAAAGAGGA), underlined in blue, identical to the primer site underlined in blue for clone #5. ( D ) Summary on the efficiency of QC2 mutagenesis in engineering 46 mutations on seven expression plasmids. The average efficiency reached 59.3%. The vector size ranged from 7.0 to 12.6 kb, with the GC-content reaching 95% for certain regions of the KAT2B and Cas9 expression vectors . Overall, QC2 mutagenesis outperforms the classical QuickChange mutagenesis method ( B) and P3 site-directed mutagenesis [ , ]. Although the efficiency is still lower than that from the P3a and P3b methods [ , ], QC2 mutagenesis is still reliable. The asterisk refers to the success rate of 46 mutants that we attempted to engineer for seven proteins: All but two (D1690A of p300, B; and Y189A of KAT2B, B) were successfully engineered. ( E ) Comparison of the four different mutagenesis methods. The P3a and P3b methods are much more efficient and faster than P3 mutagenesis [ , ]. The risk of introducing unwanted mutation is also much lower with the P3a and P3b methods. The P3 and QC2 methods frequently introduce unwanted insertions and deletions at the primer sites. Compared to the P3 method, QC2 is faster and more efficient, but it is still less efficient than the P3a and P3b methods. Second-site mutations refer to misincorporation during strand extension, which is mainly determined by the fidelity of the DNA polymerase used and distinct from primer-site insertion. The colony number refers to colonies obtained with 1 μL of a mutagenesis reaction mixture transformed into 10 μL of DH5α competent cells.
Cas9 Expression Plasmid, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cas9 expression plasmid/product/New England Biolabs
Average 99 stars, based on 1 article reviews
cas9 expression plasmid - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

Image Search Results


QC2 mutagenesis with SuperFi II polymerase to engineer Cas9 mutants. ( A ) Domain organization of Cas9 (1.1) [ , ]. Five mutants to be engineered are indicated. Upstream from the coding sequence is the CAG promoter, a synthetic promoter composed of a CMV promoter, a β-actin promoter and an intron . The CAG promoter possesses GC-rich sequences that render the plasmid incompatible with the PCR conditions described for P3a mutagenesis, so the P3b PCR conditions were used instead . ( B ) Efficiency of QC2 mutagenesis via SuperFi II DNA polymerase. An expression plasmid for human Cas9 (1.1) [ , ], as depicted in panel A, was used as the PCR template under the P3b conditions . ( C ) Analysis of 6 plasmids sequenced for engineering the K562D mutant. Clone #6 possessed two insertions, which shared two repeats of a 27-nucleotide sequence (AGTGACCGTGGATCAGCTGAAAGAGGA), underlined in blue, identical to the primer site underlined in blue for clone #5. ( D ) Summary on the efficiency of QC2 mutagenesis in engineering 46 mutations on seven expression plasmids. The average efficiency reached 59.3%. The vector size ranged from 7.0 to 12.6 kb, with the GC-content reaching 95% for certain regions of the KAT2B and Cas9 expression vectors . Overall, QC2 mutagenesis outperforms the classical QuickChange mutagenesis method ( B) and P3 site-directed mutagenesis [ , ]. Although the efficiency is still lower than that from the P3a and P3b methods [ , ], QC2 mutagenesis is still reliable. The asterisk refers to the success rate of 46 mutants that we attempted to engineer for seven proteins: All but two (D1690A of p300, B; and Y189A of KAT2B, B) were successfully engineered. ( E ) Comparison of the four different mutagenesis methods. The P3a and P3b methods are much more efficient and faster than P3 mutagenesis [ , ]. The risk of introducing unwanted mutation is also much lower with the P3a and P3b methods. The P3 and QC2 methods frequently introduce unwanted insertions and deletions at the primer sites. Compared to the P3 method, QC2 is faster and more efficient, but it is still less efficient than the P3a and P3b methods. Second-site mutations refer to misincorporation during strand extension, which is mainly determined by the fidelity of the DNA polymerase used and distinct from primer-site insertion. The colony number refers to colonies obtained with 1 μL of a mutagenesis reaction mixture transformed into 10 μL of DH5α competent cells.

Journal: Cells

Article Title: Efficiency and Fidelity of Site-Directed Mutagenesis with Complementary Primer Pairs

doi: 10.3390/cells15020138

Figure Lengend Snippet: QC2 mutagenesis with SuperFi II polymerase to engineer Cas9 mutants. ( A ) Domain organization of Cas9 (1.1) [ , ]. Five mutants to be engineered are indicated. Upstream from the coding sequence is the CAG promoter, a synthetic promoter composed of a CMV promoter, a β-actin promoter and an intron . The CAG promoter possesses GC-rich sequences that render the plasmid incompatible with the PCR conditions described for P3a mutagenesis, so the P3b PCR conditions were used instead . ( B ) Efficiency of QC2 mutagenesis via SuperFi II DNA polymerase. An expression plasmid for human Cas9 (1.1) [ , ], as depicted in panel A, was used as the PCR template under the P3b conditions . ( C ) Analysis of 6 plasmids sequenced for engineering the K562D mutant. Clone #6 possessed two insertions, which shared two repeats of a 27-nucleotide sequence (AGTGACCGTGGATCAGCTGAAAGAGGA), underlined in blue, identical to the primer site underlined in blue for clone #5. ( D ) Summary on the efficiency of QC2 mutagenesis in engineering 46 mutations on seven expression plasmids. The average efficiency reached 59.3%. The vector size ranged from 7.0 to 12.6 kb, with the GC-content reaching 95% for certain regions of the KAT2B and Cas9 expression vectors . Overall, QC2 mutagenesis outperforms the classical QuickChange mutagenesis method ( B) and P3 site-directed mutagenesis [ , ]. Although the efficiency is still lower than that from the P3a and P3b methods [ , ], QC2 mutagenesis is still reliable. The asterisk refers to the success rate of 46 mutants that we attempted to engineer for seven proteins: All but two (D1690A of p300, B; and Y189A of KAT2B, B) were successfully engineered. ( E ) Comparison of the four different mutagenesis methods. The P3a and P3b methods are much more efficient and faster than P3 mutagenesis [ , ]. The risk of introducing unwanted mutation is also much lower with the P3a and P3b methods. The P3 and QC2 methods frequently introduce unwanted insertions and deletions at the primer sites. Compared to the P3 method, QC2 is faster and more efficient, but it is still less efficient than the P3a and P3b methods. Second-site mutations refer to misincorporation during strand extension, which is mainly determined by the fidelity of the DNA polymerase used and distinct from primer-site insertion. The colony number refers to colonies obtained with 1 μL of a mutagenesis reaction mixture transformed into 10 μL of DH5α competent cells.

Article Snippet: For heat denaturation, 20 μL of the KAT2B or Cas9 expression plasmid (0.1 μg/μL with 1 × NEB restriction digestion buffer #2, Cat. B7002S, New England Biolabs, Ipswich, MA, USA) was incubated at 105 °C for 5 min before rapidly cooling on ice.

Techniques: Mutagenesis, Sequencing, Plasmid Preparation, Expressing, Comparison, Introduce, Transformation Assay